Skip to content

Unix Basics Review

Common Commands

Command Function
ls list contents
cd change directory
mkdir make a directory
rm use caution, it is easy to delete more that you would like
head prints the top few lines to the terminal window
tail prints the last few lines to the terminal window
sort sorts the lines
uniq prints the unique lines
grep filnds the lines that contain a pattern
wc counts the number of lines, characters and words
mv move files
cp copy files
date returns the current date and time
pwd return working directory name
ssh remote login
scp remote secure copy
~ represents your home directory
man [command] manual page for the command

text editors

  1. emacs
  2. vi
  3. vim
  4. nedit
  5. nano

Unix Problem Set

  • Log into your machine or account.
  • Mac Users: Open the application: Terminal
  • From Terminal: `ssh -Y student01@nucleus.biohpc.swmed.edu
  • Windows users -- Please refer to the PuTTY instructions with your username and the server nucleus.biohpc.swmed.edu
  • What is the full path to your home directory?
  • Go up one directory?
  • How many files does it contain?
  • How many directories?

  • Using a text editor create a fasta file and name it sequences.fasta. Make sure it ends up in the proper directory, locally or remotely.

  • This is fasta file format:

>seqName description ATGGCGTCTTGGCCTTAAAAGCTC

  • Without using a text editor examine the contents of the file sequences.fasta.
  • How many lines does this file contain?
  • How many characters? (Hint: check out the options of wc)
  • What is the first line of this file? (Hint: read the man page of head)
  • What are the last 3 lines? (Hint: read the man page of tail)
  • How many sequences are in the file? (Hint: use grep)

  • Rename sequences.fasta to something more informative of the sequences the file contains. (Hint: read the man page for mv)

  • Create a directory called fasta. (Hint: use mkdir)
  • Copy the fasta file that you renamed to the fasta directory. (Hint: use cp)
  • Verify that the file is within the fasta directory. (Hint: use ls fasta/)
  • Delete the the original file that you used for copying. (Hint: use rm, be careful)
  • Read the man page for rm and cp to find out how to remove and copy a directory.
  • Print out your history and redirect it to a file called unixBasics.history.txt

Commands to try

ls -l ls -lt

You can string more than one command together with a pipe (|) , such that the output of the first command is received by the second command.

ls -lt | head

You can string more than one command together with a semi-colon (;) , such that the commands run sequentially, but that output does not get passed into the next command.

date; some program command ; date

You can redirect the output of a command into a file

grep PATTERN > PATTERN.txt

You can append the output of a command to a file

grep PATTERN2 >> PATTERN.txt

You can redirect stderr to a file

command 2> filename

You can redirect the output (stdout) and stderr to a file

command &> filename